gethgvbase is a PHP script for Bio-Informatics scripts design by Colin Clarke.
It runs on following operating system: Windows / Linux / Mac OS / BSD / Solaris. gethgvbase - Extraction of single nucleotide polymorphism data from HGVBASE
Publisher review: gethgvbase - Extraction of single nucleotide polymorphism data from HGVBASE GETHGVBASE returns polymorphism data from the human genome variation dbGVDATA = gethgvbase(SNPID) reads in a %hgvbase web record from EMBL and creates a structure DATA %containing fields corresponding to the hgvBase keywords. FIELDNAME DESCRIPTIONS: a complete Þscription of field names can be found at: http://hgvbase.cgb.ki.se/cgi-bin/main.pl?page=data_struct.htmExamples:data = gethgvbase('SNP000003319')hgvData = gethgvbase('SNP000003320') Reference:HGVbase: a human sequence variation database emphasizing data quality and a broad spectrum of data sources. Nucleic Acids Res. 2002 Jan1;30(1):387-91.See also: EMBLREAD, FASTAREAD, GENPEPTREAD, %GETGENBANK, SCFREAD, SEQTOOL. data = gethgvbase('SNP000003319')data = snpID: 'SNP000003319'varType: 'SNP'varStatus: 'Proven'geneType: 'Functional Gene'geneSymbol: 'COL4A4'geneName: 'collagen, type IV, alpha 4'geneRegion: 'I-Ex:CDS 'downStreamSequence: 'CCAGGACCAGGTATGAGCCGCATGC'upStreamSequence: 'TGGGGCTCCCTGGAATGAGAGGCCC'alleles: [2x1 char]sourceId: [2x12 char]DBXREFS: [3x21 char]citation: [2x41 char]feature: [14x12 char]motifChange: []population: 'European, African and Middle East (90 individuals)'mesh: [25x31 char] Operating system: Windows / Linux / Mac OS / BSD / Solaris
After criticism received at Metro version of Internet Explorer 10 , initially offered no support for Adobe Flash technology, Microsoft has taken measures to correct this problem by working directly with Adobe to integrate the necessary components into the
Last year began to circulate on the Internet videos where Windows 8 systems boot in 7 seconds. Unfortunately, from this performance derives some problems.
New information coming from some sources close to Apple confirming that the Cupertino giant is testing two different models of iPhone, called internal iPhone5, 1 and iPhone 5.2. Apparently, both devices have a screen of 3.95 inches and a resolution of 113
Microsoft expects to launch a new wave of optimism with Windows 8. In a recent statement, Steve Ballmer, chief executive at Microsoft, estimates that Windows 8 will reach a total of about 500 million users by the end of 2013.
gethgvbase script details 
Before you Download