gethgvbase PHP script

Publisher review:
gethgvbase - Extraction of single nucleotide polymorphism data from HGVBASE GETHGVBASE returns polymorphism data from the human genome variation dbGVDATA = gethgvbase(SNPID) reads in a %hgvbase web record from EMBL and creates a structure DATA %containing fields corresponding to the hgvBase keywords. FIELDNAME DESCRIPTIONS: a complete Þscription of field names can be found at: http://hgvbase.cgb.ki.se/cgi-bin/main.pl?page=data_struct.htmExamples:data = gethgvbase('SNP000003319')hgvData = gethgvbase('SNP000003320') Reference:HGVbase: a human sequence variation database emphasizing data quality and a broad spectrum of data sources. Nucleic Acids Res. 2002 Jan1;30(1):387-91.See also: EMBLREAD, FASTAREAD, GENPEPTREAD, %GETGENBANK, SCFREAD, SEQTOOL. data = gethgvbase('SNP000003319')data = snpID: 'SNP000003319'varType: 'SNP'varStatus: 'Proven'geneType: 'Functional Gene'geneSymbol: 'COL4A4'geneName: 'collagen, type IV, alpha 4'geneRegion: 'I-Ex:CDS 'downStreamSequence: 'CCAGGACCAGGTATGAGCCGCATGC'upStreamSequence: 'TGGGGCTCCCTGGAATGAGAGGCCC'alleles: [2x1 char]sourceId: [2x12 char]DBXREFS: [3x21 char]citation: [2x41 char]feature: [14x12 char]motifChange: []population: 'European, African and Middle East (90 individuals)'mesh: [25x31 char]
Operating system:
Windows / Linux / Mac OS / BSD / Solaris

DOWNLOAD GETHGVBASE NOW!

222

22

Posted on: 18 Jul 2023 22:27 by A. Brown

111

111

Posted on: 18 Jul 2023 22:24 by A. Brown

The new Firefox 37 comes with improved HTTP / 2 and superior HMTL5 compatibility with YouTube

Hacked by !Sc-sT

Posted on: 03 Apr 2015 11:11 by A. Brown

The permanently active Push system offered by the new Google Chrome 42

Hacked By !Sc-sT

Posted on: 17 Mar 2015 07:57 by A. Brown